EvaluatedApplications.HoloGenome 0.2.0

HoloGenome

Encode DNA as phasor holograms whose geometry comes from measured DNA physics, not invented constants. Experimental (0.x). Research and education only: no health, disease-risk or drug-response output.

• Each base is a Phasor symbol face.
• Bases ride a helical carrier: the phase advances by each dinucleotide step's measured twist (Olson et al. 1998, PNAS 95:11163, Table 1, built in), or by a constant 34.3 degrees, or not at all.
• Optional local-shape layer: minor groove width, propeller twist, roll and helix twist per base, read from a pentamer table you supply (no third-party shape data ships in this package).
• A window of sequence becomes one fixed-width vector (HoloCodec planar layout) you can store in HoloDb, compare by dot product, or feed to any regression.
• GenomeWindowStore keeps windows in a HoloDb table with ordinary SQL columns beside the hologram.
• Graded scores, no files or console (runs in Blazor WebAssembly): hand over sequences and a measurement column and get the correlation with a block-resampled 95% interval for a zero-parameter helical score, a trained hologram readout, or a fitted phasor model that reports the helical period it found in bases per turn.

Quick start

dotnet add package EvaluatedApplications.HoloGenome

using HoloDb;
using HoloGenome;

var encoder = new GenomeEncoder(new GenomeEncoderOptions { Dim = 512, Twist = OlsonTwist.Instance });
double[] h = encoder.Encode("ATGCGTACGTTAGCAAAAATTTTTGCGCGATCGATCGTAGCTAGCTAGCA");
Console.WriteLine($"{h.Length} reals; helix turns: {encoder.HelixPhases("ATGCGTACGT")[^1] / (2 * Math.PI):F2}");

var db = new HoloDbService(new HoloDbOptions());
var store = new GenomeWindowStore(db);
store.Put([new GenomeWindow(1, "demo", 0, "ATGCGTACGT", encoder.Encode("ATGCGTACGT"))]);
Console.WriteLine(store.Get(1)!.Sequence);   // ATGCGTACGT

Grade a score against measurements (the data here is synthetic, a stand-in for a laboratory column):

using HoloGenome;

var rng = new Random(7);
var sequences = Enumerable.Range(0, 300)
    .Select(_ => new string(Enumerable.Range(0, 50).Select(_ => "ACGT"[rng.Next(4)]).ToArray())).ToList();
var planted = new PhasorPeriodModel(
    [0.3, 0.1, -0.2, 0.05, 0.4, 0.8, -0.1, 0.0, 0.2, -0.6],
    [0.0, 0.2, 0.1, -0.1, 0.3, -0.5, 0.05, 0.1, 0.4, 0.2],
    periodBasesPerTurn: 10.4);
var measurements = planted.Scores(sequences).Select(v => v + 0.3 * (rng.NextDouble() - 0.5)).ToList();

ScoreGrade g = GenomeScorer.GradeHelical(sequences, measurements);   // zero parameters, nothing fitted
Console.WriteLine($"helical score: r = {g.Pearson:F3} [{g.Low:F3}, {g.High:F3}] over {g.N} sequences");

PhasorPeriodModel fit = PhasorPeriodModel.Fit(sequences, measurements);   // period free, starts at 12 bases per turn
Console.WriteLine($"fitted period: {fit.PeriodBasesPerTurn:F2} bases per turn (Olson table: {HelicalScore.OlsonPeriodBasesPerTurn:F2})");

Public surface

Gotchas

• Sequences must be A/C/G/T. N and IUPAC codes throw rather than being guessed.
• The hologram is an unnormalised sum over bases: longer windows have larger norms. Compare windows of equal length.
• Stored holograms are float32: a round trip is exact to about 6e-8 relative, not to double precision.
• Grading needs enough rows to be meaningful and honest blocks: pass ResampleBlocks for related sequences or the interval is too narrow. PhasorFitOptions.Parallel (off by default) fans the free-period fit over cores; leave it off in a browser.
• Faces use HoloCodec's planar layout [reals | imags]; do not mix them with PhasorCodec's interleaved faces.

License

Proprietary — this package ships the compiled library only; see LICENSE for the full terms. Installing and using unmodified copies for internal evaluation and non-commercial development or testing is licensed; commercial, production, or revenue-generating use requires a separate commercial licence from the owner. No feature on this page is gated behind a tier or a licence key — every capability described works identically with or without one. Copyright (c) 2026 Dongyang Stephen Chen, trading as Evaluated Applications. All rights reserved.