Gravicode.Biotech.Net.Core 0.1.0

Biotech.Net

Ultimate Biotechnology & Bioinformatics Platform for .NET — the Bioconductor + Biopython of .NET 10, with Rust-accelerated kernels.

Dibuat oleh Gravicode Studios dipimpin oleh Kang Fadhil

English

Biotech.Net is an open-source platform for biotechnology, bioinformatics, computational biology, genomics, proteomics, drug discovery, synthetic biology and biotech AI, built for .NET 10. Hot paths run on Rust kernels through a C ABI; every kernel also has a managed C# implementation, so the library works even without the native binary.

Quick start

dotnet add package Gravicode.Biotech.Net.Core
dotnet add package Gravicode.Biotech.Net.Sequences

using Biotech.Net.Core;
using Biotech.Net.Sequences;

var dna = Sequence.Dna("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", "demo");
Console.WriteLine($"{dna.Length} bp, GC {dna.GcContent():P1}");
Console.WriteLine(dna.ReverseComplement());
Console.WriteLine(dna.Translate(toStop: true));              // MAIVMGR
Console.WriteLine($"{OrfFinder.Find(dna, new OrfOptions { MinLength = 30 }).Count} ORFs");

Modules

Documentation

• English: docs/en — getting started, installation, tutorials, API reference, samples, benchmarks, roadmap
• Bahasa Indonesia: docs/id

Every C# snippet in the documentation is compiled and executed against the real API before publication, and every figure is rendered by Biotech.Net.Visualization itself.

Performance

Measured on an Intel Core i7-8650U (BenchmarkDotNet, short job). Ratio is Rust time ÷ managed time, so lower is faster:

Full results, including the cases where the managed path currently wins: docs/en/benchmarks.md.

Bahasa Indonesia

Biotech.Net adalah platform open-source untuk bioteknologi, bioinformatika, biologi komputasi, genomika, proteomika, penemuan obat, biologi sintetik, dan AI bioteknologi, dibangun untuk .NET 10. Jalur kritis berjalan di kernel Rust lewat C ABI; setiap kernel juga punya implementasi C# managed, jadi pustaka ini tetap bekerja tanpa biner native.

Mulai cepat

dotnet add package Gravicode.Biotech.Net.Core
dotnet add package Gravicode.Biotech.Net.Sequences

using Biotech.Net.Core;
using Biotech.Net.Sequences;

var dna = Sequence.Dna("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", "demo");
Console.WriteLine($"{dna.Length} bp, GC {dna.GcContent():P1}");
Console.WriteLine(dna.ReverseComplement());
Console.WriteLine(dna.Translate(toStop: true));              // MAIVMGR
Console.WriteLine($"{OrfFinder.Find(dna, new OrfOptions { MinLength = 30 }).Count} ORF");

Modul

Daftar paket sama seperti tabel di bagian Inggris di atas: Native, Core, Sequences, Alignments, Genomics, Transcriptomics, Proteomics, StructuralBiology, Chemistry, DrugDiscovery, SyntheticBiology, AI, Visualization, dan Notebooks — semuanya diawali Gravicode.Biotech.Net..

Dokumentasi

• Bahasa Indonesia: docs/id — pendahuluan, instalasi, tutorial, referensi API, contoh, benchmark, roadmap
• English: docs/en

Setiap cuplikan C# di dokumentasi dikompilasi dan dijalankan terhadap API yang sebenarnya sebelum diterbitkan, dan setiap gambar dirender oleh Biotech.Net.Visualization sendiri.

Screenshots — Biotech.Net Gallery

The Avalonia showcase (samples/Biotech.Net.Gallery): six modules, each running real library code with a live code tab and PNG/SVG export.

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/screenshots/gallery-dna-explorer.png" alt="DNA Explorer" width="720" />

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/screenshots/gallery-genome-browser.png" alt="Genome Browser" width="720" />

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/screenshots/gallery-protein-explorer.png" alt="Protein Explorer" width="720" />

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/screenshots/gallery-drug-discovery-lab.png" alt="Drug Discovery Lab" width="720" />

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/screenshots/gallery-ai-playground.png" alt="AI Playground" width="720" />

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/screenshots/gallery-crispr-designer.png" alt="CRISPR Designer" width="720" />

Example figures produced by Biotech.Net.Visualization:

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/images/genome-browser.png" alt="Genome browser plot" width="720" />

<img src="https://raw.githubusercontent.com/DotNetVibeCoderz/Vibe_Bio/main/Biotech.Net/docs/images/volcano.png" alt="Volcano plot" width="560" />

Building from source

dotnet build Biotech.Net.slnx                  # builds the Rust crate too when cargo is on PATH
dotnet build -p:SkipRustBuild=true             # reuse an existing native binary
dotnet test Biotech.Net.slnx
cd native/biotech-native && cargo test --release

Requires the .NET 10 SDK. The Rust toolchain is optional — without it every kernel falls back to managed C#.

Credits & license

Dibuat oleh Gravicode Studios dipimpin oleh Kang Fadhil · Created by Gravicode Studios, led by Kang Fadhil.

Licensed under the MIT License. Copyright © Gravicode Studios.