Core.Cast-Transform-Convert 3.2.0.91

There is a newer version of this package available.
See the version list below for details.
dotnet add package Core.Cast-Transform-Convert --version 3.2.0.91
NuGet\Install-Package Core.Cast-Transform-Convert -Version 3.2.0.91
This command is intended to be used within the Package Manager Console in Visual Studio, as it uses the NuGet module's version of Install-Package.
<PackageReference Include="Core.Cast-Transform-Convert" Version="3.2.0.91" />
For projects that support PackageReference, copy this XML node into the project file to reference the package.
paket add Core.Cast-Transform-Convert --version 3.2.0.91
#r "nuget: Core.Cast-Transform-Convert, 3.2.0.91"
#r directive can be used in F# Interactive and Polyglot Notebooks. Copy this into the interactive tool or source code of the script to reference the package.
// Install Core.Cast-Transform-Convert as a Cake Addin
#addin nuget:?package=Core.Cast-Transform-Convert&version=3.2.0.91

// Install Core.Cast-Transform-Convert as a Cake Tool
#tool nuget:?package=Core.Cast-Transform-Convert&version=3.2.0.91

An easy-to-use, portable, tested, documented, serializable, thread-safe, strongly typed library for changing between unrestricted, arbitrary data types

There are no supported framework assets in this package.

Learn more about Target Frameworks and .NET Standard.

NuGet packages

This package is not used by any NuGet packages.

GitHub repositories

This package is not used by any popular GitHub repositories.

Version Downloads Last updated
3.2.0.94 2,154 11/1/2016
3.2.0.93 1,676 11/1/2016
3.2.0.92 1,687 11/1/2016
3.2.0.91 1,729 11/1/2016
3.2.0.89 1,404 10/19/2016
3.2.0.86 1,454 10/17/2016
3.2.0.84 1,481 10/17/2016
3.2.0.82 1,478 10/17/2016
3.2.0.81 1,448 10/14/2016
3.2.0.80 1,436 10/14/2016
3.2.0.79 1,452 10/14/2016
3.2.0.78 1,492 10/13/2016
3.2.0.77 1,424 10/13/2016
3.2.0 1,415 10/13/2016
3.1.0.69 1,414 10/9/2016
3.1.0.5 1,561 10/9/2016
3.1.0.2 2,230 9/21/2016
3.1.0 1,443 10/3/2016
3.0.1.4 1,508 9/13/2016
3.0.1 1,427 10/3/2016

=== Key Features ===

-Central thread-safe pool of converting functions
-Data Encapsulation
-Add converters at runtime or compile-time
-Consistent exception behavior
-Optional functions following the "Try" convention of .NET
-Instant improvement of source-code readability and maintainability
-Low overall performance impact
-Little to no learning curve
-Independent, portable library

______________________________________________________

### Changelog with the most recent changes

* 50 seconds ago  (HEAD -> master, origin/master, origin/HEAD) Tests: Added missing dipose-call (Lorenz Lo Sauer)
* 4 minutes ago  Tests: added comprehensive test evalutation using the 'dynamc ' collection setting (Lorenz Lo Sauer)
* 7 minutes ago  Tests: added test scenariors to check the functionality of the deferred  AddBuilder class (Lorenz Lo Sauer)
* 26 minutes ago  Tests: Added crucial test for probing the intregrity of the ConverterCollection (Lorenz Lo Sauer)
*    27 minutes ago  Merge branch 'master' of https://github.com/lsauer/dotnet-portable-cast-convert-transform (Lorenz Lo Sauer)
|\  
| * 5 days ago  Readme: added stackoverflow flair-theme [ci skip] (Lorenz Lo Sauer)
* | 39 minutes ago  Tests: Moved two tests from ConvertTo and added separate, advanced  tests for CastTo; (Lorenz Lo Sauer)
|/  
*    13 days ago  Merge branch 'master' of https://github.com/lsauer/dotnet-portable-cast-convert-transform (Lorenz Lo Sauer)
|\  
| * 13 days ago  appveyor: added powershell scripts to the set of monitored build-files (Lorenz Lo Sauer)
* | 13 days ago  appveyor: added powershell scripts to the set of monitored build-files (Lorenz Lo Sauer)
|/  
* 13 days ago  Nuget packaging: fixed missing dynamic build-path in the nuspec file (Lorenz Lo Sauer)
* 13 days ago  Tests: Added new tests to the csproj; Added a direct csproj reference to the TypeCast library (Lorenz Lo Sauer)
* 13 days ago  Tests: Added tests for custom NumberFormatInfo based conversions [ci skip] (Lorenz Lo Sauer)
* 13 days ago  Improved: Added a new ConverterCollectionCause to the exception enumeration list; Better handling of a missing assembly exception during initialization (Lorenz Lo Sauer)
* 13 days ago  Improved: Renamed variable to better reflect its purpose [ci skip] (Lorenz Lo Sauer)
* 13 days ago   Improved: Allow Disambiguates when the ConverterMethodAttribute has a Name property set (Lorenz Lo Sauer)
* 13 days ago  Improved: Better creation of Standard Converters, designated with object as Argument-Type [ci skip] (Lorenz Lo Sauer)
* 13 days ago  Tests: Added a CaptureDataException for throwing data-objects at a desired point outside a method for analysis [ci skip] (Lorenz Lo Sauer)
* 13 days ago  Improved: Cleaned up unecessary code-lines (Lorenz Lo Sauer)
* 2 weeks ago  Changed: Removed binaries due to a DevOps pipeline and automated release builds (Lorenz Lo Sauer)
* 2 weeks ago  Deploy: Include dynamic changelog of the most recent changes in the nuget package (Lorenz Lo Sauer)
* 2 weeks ago  Deploy: Improved Nuget packaging script to handle x64 platform packaging (Lorenz Lo Sauer)

______________________________________________________

### Getting started in 4 steps

1. *Install* with the <a href="http://goo.gl/iekUWH" target="_blank">NuGet Package manager</a>: `PM> Install-Package Core.TypeCast`.  
2. *Add the namespace* to your top-listed using directives: `using Core.TypeCast;`.
3. *Create a class* with one or more methods: `class MyConverter { ... int MyConverter(string argument) ... }`
4. *Attribute* any class with `[ConverterAttribute]`: _`public class MyConverter { ... }`_.    
   Subsequently, attribute the converting methods using `[ConverterMethodAttribute]`: _`public int MyConverter(string attribute){ ... }`__
5. **Done!**

Now, invoke conversions in your code anywhere as follows:
```cs
   var castedInt = "500s".CastTo<int>();
   var protein = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".ConvertTo<IProtein>();
```
Use library functions which suit the change of type descriptively:

   `var complimentary = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".Transform<Complementary>();`


_____________________________________________________

### Code Glance

Provided below is an abbreviated example of what code may look like in your project:

```cs
   using System.Runtime.CompilerServices;
   // IPolyNucleotide.cs
   public interface IPolyNucleotide { ... }

   // used for "Tranform-Aliasing"
   delegate DNA Complimentary(string dnaSequence, AModelClass arguments);

   // DNA.cs
   [Converter]
   public class DNA : IPolyNucleotide
   {
       [ConverterMethod]
       protected IProtein ToProtein(string dnaSequence, bool homologyLookup = false)
       {
           ... ...
       }

       [ConverterMethod]
       [MethodImpl(MethodImplOptions.AggressiveInlining)]
       public static DNA Complimentary(string dnaSequence, AModelClass arguments)
       {
           ... ...
       }
       ...
   }
```